nup107

Ensembl ID:
ENSDARG00000016010
ZFIN ID:
ZDB-GENE-041210-245
Description:
nuclear pore complex protein Nup107 [Source:RefSeq peptide;Acc:NP_001025338]
Human Orthologue:
NUP107
Human Description:
nucleoporin 107kDa [Source:HGNC Symbol;Acc:29914]
Mouse Orthologue:
Nup107
Mouse Description:
nucleoporin 107 Gene [Source:MGI Symbol;Acc:MGI:2143854]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11499 Nonsense Available for shipment Available now
sa9555 Nonsense Available for shipment Available now
sa40296 Nonsense Mutation detected in F1 DNA During 2017
sa33466 Nonsense Mutation detected in F1 DNA During 2017
sa840 Nonsense Available for shipment Available now
sa31398 Nonsense Available for shipment Available now
sa12652 Nonsense Available for shipment Available now
sa12659 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11499
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040033 Nonsense 156 919 6 26
ENSDART00000040033 Nonsense 156 919 6 26
Genomic Location (Zv9):
Chromosome 4 (position 21682006)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23025341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTTCTCTTAGCTTCTCTTGGTTTGTTTCCTGAATTCCTGGAGTCTTA[T/A]TTGCGTCATGCGTCCACAGCMGTGTTTGACCTGTTGGAGGAATATGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9555
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040033 Nonsense 156 919 6 26
ENSDART00000040033 Nonsense 156 919 6 26
Genomic Location (Zv9):
Chromosome 4 (position 21682006)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23025341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTTCTCTTAGCTTCTCTTGGTTTGTTTCCTGAATTCCTGGAGTCTTA[T/A]TTGCGTCATGCGTCCACAGCMGTGTTTGACCTGTTGGAGGAATATGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40296
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040033 Nonsense 266 919 10 26
Genomic Location (Zv9):
Chromosome 4 (position 21679515)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23022850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAAGCTCAATATCTGATGTGTGTTTTTATTTAGCTGGTGGTGGATTG[G/A]TTGGAGAGTATAGCAAAAGACGATATAGGAGACTTCTCGGATAACATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33466
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040033 Nonsense 574 919 19 26
Genomic Location (Zv9):
Chromosome 4 (position 21674385)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23017720
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCAGGAGGAGGTGTGTGTAGATGTCCTGAAGGCCTACATCTCGCTGT[T/A]GGTGAAGGAAAAGCAGGTGGAGCTCATTGCGTTTTACGTCAGTCACCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa840
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040033 Nonsense 615 919 19 26
Genomic Location (Zv9):
Chromosome 4 (position 21674261)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23017596
KASP Assay ID:
554-0743.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGCTCAGTTCCTGGAGGAAGTCACTGAGACTGAGCAGCGCAAACACTG[T/A]CTGGAGCTCGCAACACAAGCAGGCAGGTTTATTTTGCACTAAAGAGTCCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa31398
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040033 Nonsense 747 919 22 26
Genomic Location (Zv9):
Chromosome 4 (position 21671892)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23015227
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGCAGAAGAGGAGAATGCCATTCGTGAACATCTATGCATTCGTGCTTA[T/A]CTGGTGAGTAGTGCTGTTGTACAATGAATTGACCTAAAGTCAAATCAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12652
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040033 Nonsense 915 919 26 26
ENSDART00000040033 Nonsense 915 919 26 26
Genomic Location (Zv9):
Chromosome 4 (position 21666605)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23009940
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGAATCCTCTCTKCTTCTTCTGGATAAAGGACTGGATCCTCTGGGATA[T/A]GAGATTCAGCCCTAGCCAGTGTTTCCTCATGCTTGTTTTTTTCCTCACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12659
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040033 Nonsense 915 919 26 26
ENSDART00000040033 Nonsense 915 919 26 26
Genomic Location (Zv9):
Chromosome 4 (position 21666605)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23009940
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGAATCCTCTCTKCTTCTTCTGGATAAAGGACTGGATCCTCTGGGATA[T/A]GAGATTCAGCCCTAGCCAGTGTTTCCTCATGCTTGTTTTTTTCCTCACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link