mfsd5

Ensembl ID:
ENSDARG00000015997
ZFIN ID:
ZDB-GENE-040718-468
Description:
Major facilitator superfamily domain-containing protein 5 [Source:UniProtKB/Swiss-Prot;Acc:Q6DG19]
Human Orthologue:
MFSD5
Human Description:
major facilitator superfamily domain containing 5 [Source:HGNC Symbol;Acc:28156]
Mouse Orthologue:
Mfsd5
Mouse Description:
major facilitator superfamily domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2145901]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12309 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12309
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011004 None None 481 2 3
ENSDART00000141141 Essential Splice Site None 200 2 3
ENSDART00000142369 Essential Splice Site None 152 2 3
Genomic Location:
Chromosome 23 (position 35841422)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTTTTTTNCAGAAGTCAAGCTGACAGTYGCTCATGATGAGTCCAGAA[G/A]TGAGTTTATCCAACWGTCATGTGTCACGTGATGATGTATGATCACTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/77wepsvt