hcfc1a

Ensembl ID:
ENSDARG00000015990
ZFIN ID:
ZDB-GENE-030912-10
Description:
host cell factor C1a [Source:RefSeq peptide;Acc:NP_001038529]
Human Orthologue:
HCFC1
Human Description:
host cell factor C1 (VP16-accessory protein) [Source:HGNC Symbol;Acc:4839]
Mouse Orthologue:
Hcfc1
Mouse Description:
host cell factor C1 Gene [Source:MGI Symbol;Acc:MGI:105942]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21913 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014945 Nonsense 119 1802 4 28
Genomic Location (Zv9):
Chromosome 11 (position 26390343)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25219168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAATGATCTCACTATAATTACTGTCATCAGGCAAGCAGGTGGGAATG[G/A]AAAAAATTGAAGCCAAAAGCCCCTAAGAATGGAGTGCCACCATGTCCTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link