abcc9

Ensembl ID:
ENSDARG00000015985
ZFIN ID:
ZDB-GENE-050517-23
Description:
ATP-binding cassette sub-family C member 9 [Source:RefSeq peptide;Acc:NP_001025325]
Human Orthologue:
ABCC9
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 9 [Source:HGNC Symbol;Acc:60]
Mouse Orthologue:
Abcc9
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 9 Gene [Source:MGI Symbol;Acc:MGI:1352630]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8868 Nonsense Mutation detected in F1 DNA During 2014
sa8414 Nonsense Mutation detected in F1 DNA During 2014
sa18175 Essential Splice Site Available for shipment Available now
sa17129 Nonsense Available for shipment Available now
sa5254 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8868
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013990 Nonsense 576 1558 12 37
ENSDART00000079987 Nonsense 488 1409 10 33
ENSDART00000013990 Nonsense 576 1558 12 37
ENSDART00000079987 Nonsense 488 1409 10 33
Genomic Location:
Chromosome 4 (position 13741511)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACCTTCGTCACACATGCCTACATTGAGGAGGACAGGCTCAGTCCTGCC[A/T]AGGCATTTGCCTCTTTGGCKCTATTCCACATYCTGGTCACTCCACTCTTY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8414
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013990 Nonsense 576 1558 12 37
ENSDART00000079987 Nonsense 488 1409 10 33
ENSDART00000013990 Nonsense 576 1558 12 37
ENSDART00000079987 Nonsense 488 1409 10 33
Genomic Location:
Chromosome 4 (position 13741511)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACCTTCGTCACACATGCCTACATTGAGGAGGACAGGCTCAGTCCTGCC[A/T]AGGCATTTGCCTCTTTGGCKCTATTCCACATYCTGGTCACTCCACTCTTY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18175
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013990 Essential Splice Site 645 1558 13 37
ENSDART00000079987 Essential Splice Site 557 1409 11 33
Genomic Location:
Chromosome 4 (position 13741793)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGTGYATGTCTCTTGAAGTCGGCAAGAAATACAAATACCAAGGCGAT[G/T]TGAGTAGGYACACACAACCTTTCAACACAATTTCAGATAGTTTGTGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17129
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013990 Nonsense 800 1558 18 37
ENSDART00000079987 Nonsense 712 1409 16 33
Genomic Location:
Chromosome 4 (position 13756579)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAACCAGATATCGACCTCCTTCCTTTTGGAGACCAGACTGAAATCGGA[G/T]AGCGGGTAAGACTGTCTCTGGGCTTGAAACCAGCTCTCTGACCTCAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013990 None None 1558 None 37
ENSDART00000079987 Essential Splice Site 1365 1409 33 33
Genomic Location:
Chromosome 4 (position 13779026)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCAYCCRCTTAAGCACTGTTTGACCATACAGAGATATGTATTTTCTGC[A/T]GCATCGTGTGCACACAATCCTGACGGCGGATCTAGTGATCGTGATGAAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hdrhdhyp