Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
abcc9
- Ensembl ID:
- ENSDARG00000015985
- ZFIN ID:
- ZDB-GENE-050517-23
- Description:
- ATP-binding cassette sub-family C member 9 [Source:RefSeq peptide;Acc:NP_001025325]
- Human Orthologue:
- ABCC9
- Human Description:
- ATP-binding cassette, sub-family C (CFTR/MRP), member 9 [Source:HGNC Symbol;Acc:60]
- Mouse Orthologue:
- Abcc9
- Mouse Description:
- ATP-binding cassette, sub-family C (CFTR/MRP), member 9 Gene [Source:MGI Symbol;Acc:MGI:1352630]
Alleles
There are 6 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa26260 | Nonsense | Mutation detected in F1 DNA | During 2017 |
| sa8868 | Nonsense | Mutation detected in F1 DNA | During 2017 |
| sa8414 | Nonsense | Mutation detected in F1 DNA | During 2017 |
| sa18175 | Essential Splice Site | Available for shipment | Available now |
| sa17129 | Nonsense | Available for shipment | Available now |
| sa38431 | Nonsense | Mutation detected in F1 DNA | During 2017 |
Mutation Details
- Allele Name:
- sa26260
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2017.
- Mutation:
- G > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000013990 | Nonsense | 143 | 1558 | 4 | 37 |
| ENSDART00000079987 | Nonsense | 55 | 1409 | 2 | 33 |
- Genomic Location (Zv9):
- Chromosome 4 (position 13730723)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 14666576 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATTCAAACCTAATCAACCTAACCTCTTTCACAGCCTTATTTATTTACTG[G/A]ATTCTGGCTTTCATCACAAAGATGATAAAGTTATGGAAGTTTGCCGAGGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8868
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2017.
- Mutation:
- A > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000013990 | Nonsense | 576 | 1558 | 12 | 37 |
| ENSDART00000079987 | Nonsense | 488 | 1409 | 10 | 33 |
| ENSDART00000013990 | Nonsense | 576 | 1558 | 12 | 37 |
| ENSDART00000079987 | Nonsense | 488 | 1409 | 10 | 33 |
- Genomic Location (Zv9):
- Chromosome 4 (position 13741511)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 14677364 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGACCTTCGTCACACATGCCTACATTGAGGAGGACAGGCTCAGTCCTGCC[A/T]AGGCATTTGCCTCTTTGGCKCTATTCCACATYCTGGTCACTCCACTCTTY
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8414
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2017.
- Mutation:
- A > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000013990 | Nonsense | 576 | 1558 | 12 | 37 |
| ENSDART00000079987 | Nonsense | 488 | 1409 | 10 | 33 |
| ENSDART00000013990 | Nonsense | 576 | 1558 | 12 | 37 |
| ENSDART00000079987 | Nonsense | 488 | 1409 | 10 | 33 |
- Genomic Location (Zv9):
- Chromosome 4 (position 13741511)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 14677364 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGACCTTCGTCACACATGCCTACATTGAGGAGGACAGGCTCAGTCCTGCC[A/T]AGGCATTTGCCTCTTTGGCKCTATTCCACATYCTGGTCACTCCACTCTTY
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18175
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000013990 | Essential Splice Site | 645 | 1558 | 13 | 37 |
| ENSDART00000079987 | Essential Splice Site | 557 | 1409 | 11 | 33 |
- Genomic Location (Zv9):
- Chromosome 4 (position 13741793)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 14677646 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATATGTGYATGTCTCTTGAAGTCGGCAAGAAATACAAATACCAAGGCGAT[G/T]TGAGTAGGYACACACAACCTTTCAACACAATTTCAGATAGTTTGTGTCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17129
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000013990 | Nonsense | 800 | 1558 | 18 | 37 |
| ENSDART00000079987 | Nonsense | 712 | 1409 | 16 | 33 |
- Genomic Location (Zv9):
- Chromosome 4 (position 13756579)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 14692432 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTCAACCAGATATCGACCTCCTTCCTTTTGGAGACCAGACTGAAATCGGA[G/T]AGCGGGTAAGACTGTCTCTGGGCTTGAAACCAGCTCTCTGACCTCAGCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38431
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2017.
- Mutation:
- G > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000013990 | Nonsense | 1454 | 1558 | 35 | 37 |
| ENSDART00000079987 | Nonsense | 1265 | 1409 | 30 | 33 |
- Genomic Location (Zv9):
- Chromosome 4 (position 13775614)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 14711467 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGTCATGCTTTATGTTTGACTTTCGTCCCGCAGACGCTGTGGTGACCGAA[G/T]GAGGAGAGAACTTCAGTGTGGGACAGAGGCAGCTATTTTGTCTCGCCCGG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
