NP_957420.1

Ensembl ID:
ENSDARG00000015971
Description:
Rap guanine nucleotide exchange factor (GEF) 1 [Source:RefSeq peptide;Acc:NP_957420]
Human Orthologue:
RAPGEF1
Human Description:
Rap guanine nucleotide exchange factor (GEF) 1 [Source:HGNC Symbol;Acc:4568]
Mouse Orthologue:
Rapgef1
Mouse Description:
Rap guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI Symbol;Acc:MGI:104580]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32327 Nonsense Available for shipment Available now
sa18460 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32327
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015576 Nonsense 102 684 2 16
ENSDART00000123759 Nonsense 127 1080 3 24
ENSDART00000127761 Nonsense 102 684 2 16
ENSDART00000144179 Nonsense 103 621 2 11
Genomic Location (Zv9):
Chromosome 21 (position 4423648)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4001060
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGTTCGGCTAGTAAAGTTTTAGAGGCTATTTTGCCTCTGATGCAGGTC[G/T]AGGCTCGGATACAGCACAGGTGAGTATTCACTGCTAATAAACATCGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18460
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015576 Nonsense 128 684 3 16
ENSDART00000123759 Nonsense 153 1080 4 24
ENSDART00000127761 Nonsense 128 684 3 16
ENSDART00000144179 Nonsense 129 621 3 11
Genomic Location (Zv9):
Chromosome 21 (position 4423919)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4001331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTCCTGTCACAACCGTGTTTATCAGAGCTTGGCGACTCTGATTCGCTG[G/A]TCCGACCAGGTGATGCTGGAGGGYATCGAYCTCGACGACAAGGACACTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link