NP_001038733.1

Ensembl ID:
ENSDARG00000015966
Description:
YY1-associated factor 2 [Source:RefSeq peptide;Acc:NP_001038733]
Human Orthologue:
YAF2
Human Description:
YY1 associated factor 2 [Source:HGNC Symbol;Acc:17363]
Mouse Orthologue:
Yaf2
Mouse Description:
YY1 associated factor 2 Gene [Source:MGI Symbol;Acc:MGI:1914307]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6932 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6932
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080334 Essential Splice Site 9 182 None 4

The following transcripts of ENSDARG00000015966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 12985629)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13922256
KASP Assay ID:
554-5039.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCCCACAAAACTTTCTGCAGCATGGGAGACAAGAGGAGTCCGACGAGG[T/C]AAAAACAAACAGAAAGAAACTCCCACWGCCGTGGCTTCAAGAAGAGGTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link