TSHZ3 (1 of 2)

Ensembl ID:
ENSDARG00000015959
Description:
teashirt zinc finger homeobox 3 [Source:HGNC Symbol;Acc:30700]
Human Orthologue:
TSHZ3
Human Description:
teashirt zinc finger homeobox 3 [Source:HGNC Symbol;Acc:30700]
Mouse Orthologue:
Tshz3
Mouse Description:
teashirt zinc finger family member 3 Gene [Source:MGI Symbol;Acc:MGI:2442819]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7083 Nonsense Mutation detected in F1 DNA During 2014
sa15444 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032123 Nonsense 299 1066 3 4
Genomic Location:
Chromosome 7 (position 48341314)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCAGCCAAGATTATCTCCTCAGCTCGTAAAAGAGCCCCTATTGAGCTA[G/T]AACTCCCCAGCTCACCAGATTCTAACGGTGGCACCCCCAAGCCTTCTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15444
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032123 Nonsense 1028 1066 4 4
Genomic Location:
Chromosome 7 (position 48339059)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCCCTCCCCTTCCCCAGATGWGGAGGCAAATGGCACCTCRTATCAGTG[T/A]AAACTGTGTAATCGGACTTTTGCCAGCAAACACGCCGTCAAGCTCCATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ad1zetek