TSHZ3 (1 of 2)

Ensembl ID:
ENSDARG00000015959
Description:
teashirt zinc finger homeobox 3 [Source:HGNC Symbol;Acc:30700]
Human Orthologue:
TSHZ3
Human Description:
teashirt zinc finger homeobox 3 [Source:HGNC Symbol;Acc:30700]
Mouse Orthologue:
Tshz3
Mouse Description:
teashirt zinc finger family member 3 Gene [Source:MGI Symbol;Acc:MGI:2442819]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7083 Nonsense Mutation detected in F1 DNA During 2016
sa40987 Nonsense Mutation detected in F1 DNA During 2016
sa34161 Nonsense Mutation detected in F1 DNA During 2016
sa15444 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032123 Nonsense 299 1066 3 4
Genomic Location (Zv9):
Chromosome 7 (position 48341314)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46459425
KASP Assay ID:
554-5130.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCAGCCAAGATTATCTCCTCAGCTCGTAAAAGAGCCCCTATTGAGCTA[G/T]AACTCCCCAGCTCACCAGATTCTAACGGTGGCACCCCCAAGCCTTCTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40987
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032123 Nonsense 481 1066 3 4
Genomic Location (Zv9):
Chromosome 7 (position 48340766)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46458877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCAGCAGAAAGCGAAACTGATGAGAAGTTTGAAGTTTCATCCAAGTA[T/A]CCATATTTGACAGAGGAAGATCTTGAAGAAAGCCCTAAGGGGGGGTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34161
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032123 Nonsense 920 1066 3 4
Genomic Location (Zv9):
Chromosome 7 (position 48339450)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46457561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCAAGTACATTATGTCAGACCTCAGTCCACAGGAGCGCATGCATATTT[C/A]GCGCTTTACTGGACTCTCAATGACGACCATTAGCCACTGGCTAGCAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15444
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032123 Nonsense 1028 1066 4 4
Genomic Location (Zv9):
Chromosome 7 (position 48339059)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 46457170
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCCCTCCCCTTCCCCAGATGWGGAGGCAAATGGCACCTCRTATCAGTG[T/A]AAACTGTGTAATCGGACTTTTGCCAGCAAACACGCCGTCAAGCTCCATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link