matn4

Ensembl ID:
ENSDARG00000015947
ZFIN ID:
ZDB-GENE-050208-64
Description:
matrilin-2 [Source:RefSeq peptide;Acc:NP_998714]
Human Orthologue:
MATN4
Human Description:
matrilin 4 [Source:HGNC Symbol;Acc:6910]
Mouse Orthologue:
Matn4
Mouse Description:
matrilin 4 Gene [Source:MGI Symbol;Acc:MGI:1328314]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5389 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18675 Essential Splice Site Available for shipment Available now
sa15898 Nonsense Available for shipment Available now
sa40795 Nonsense Mutation detected in F1 DNA During 2016
sa40796 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa5389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002571 Essential Splice Site 213 698 4 13
ENSDART00000065681 Essential Splice Site 213 944 3 18
ENSDART00000065682 Essential Splice Site 213 821 4 16
ENSDART00000065683 Essential Splice Site 213 637 4 14
ENSDART00000077761 Essential Splice Site 213 657 4 12
ENSDART00000077763 Essential Splice Site 213 561 4 14
ENSDART00000103118 Essential Splice Site 213 441 4 11
Genomic Location:
Chromosome 6 (position 52763545)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATATAGTGTTTCTGCTTCAGCGGTGTTCATGTGTGTGTTGGATTTTTGC[A/C]GGGATGGACTTGTGCCTGGAGTCCGATCAYGGCTGTGAGCACATCTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18675
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002571   None 698 None 13
ENSDART00000065681 Essential Splice Site 541 944 11 18
ENSDART00000065682   None 821 None 16
ENSDART00000065683   None 637 None 14
ENSDART00000077761   None 657 None 12
ENSDART00000077763 Essential Splice Site 336 561 7 14
ENSDART00000103118   None 441 None 11
Genomic Location:
Chromosome 6 (position 52777937)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCCAACAACTTTGGCCACTAAACKTCTCTGCTTCTCTCTGCCCGWTCC[A/G]GTGATCGACTACTGTTCAKTCGGGAATGAKAGCTGCGAGCACCAGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15898
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002571   None 698 None 13
ENSDART00000065681 Nonsense 612 944 12 18
ENSDART00000065682 Nonsense 489 821 10 16
ENSDART00000065683 Nonsense 407 637 8 14
ENSDART00000077761   None 657 None 12
ENSDART00000077763 Nonsense 407 561 8 14
ENSDART00000103118   None 441 None 11
Genomic Location:
Chromosome 6 (position 52779768)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTGTGTGAGTGTCCTCAATGGTTTTCACTGCCGTTGTAAGGACGGATA[C/A]ACCCTCAATGAGGACAAGAAGACCTGTACAAGTTAGTGAGARTAACTNGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40795
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002571 Nonsense 461 698 10 13
ENSDART00000065681 Nonsense 707 944 15 18
ENSDART00000065682 Nonsense 584 821 13 16
ENSDART00000065683 Nonsense 502 637 11 14
ENSDART00000077761 Nonsense 420 657 9 12
ENSDART00000077763 Nonsense 502 561 11 14
ENSDART00000103118 Nonsense 379 441 8 11
Genomic Location:
Chromosome 6 (position 52783116)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAAAAAAATAACATTGAAATGAACTTCTGTTGATTTCTCCAAGCTTGT[C/T]GAACCTCCAACATCGACCTGGTCCTGCTCATCGATGGCTCCAAGAGTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40796
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002571 Nonsense 670 698 12 13
ENSDART00000065681 Nonsense 916 944 17 18
ENSDART00000065682 Nonsense 793 821 15 16
ENSDART00000065683   None 637 13 14
ENSDART00000077761 Nonsense 629 657 11 12
ENSDART00000077763   None 561 13 14
ENSDART00000103118   None 441 10 11
Genomic Location:
Chromosome 6 (position 52792971)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCGAGGTGAAAGATCCCTGTGCCTGTGAGAGTCTGGTGGAGTTTCAA[C/T]AGGTCACGATGTCCACCATTGAGCAGCTCAACCAGAAACATATCCTTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link