dlat

Ensembl ID:
ENSDARG00000015918
ZFIN ID:
ZDB-GENE-030131-2921
Description:
dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex, mitochond
Human Orthologue:
DLAT
Human Description:
dihydrolipoamide S-acetyltransferase [Source:HGNC Symbol;Acc:2896]
Mouse Orthologue:
Dlat
Mouse Description:
dihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex) Gene [Source:M

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37306 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37305 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37306
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016502 Essential Splice Site 221 652 5 14
Genomic Location (Zv9):
Chromosome 21 (position 22144264)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22992677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAGCGTAATATTATATGTCATAATTAACTTCCTGTTTTTCTTTCTTTA[G/T]GTGCTTCTTCCAGCTCTCTCACCCACCATGACTATGGGCACCGTGCAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016502 Essential Splice Site 263 652 5 14
Genomic Location (Zv9):
Chromosome 21 (position 22144135)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22992548
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGAGGGAGACCTGCTGGCTGAAATCGAGACAGATAAGGCAACAATCGG[T/A]AAATTAATTCAATTATTTTGGCTATAATTATTATAATTTAGTAATAATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link