mcm2

Ensembl ID:
ENSDARG00000015911
ZFIN IDs:
ZDB-GENE-020419-24, ZDB-GENE-020419-24
Description:
DNA replication licensing factor MCM2 [Source:RefSeq peptide;Acc:NP_775364]
Human Orthologue:
MCM2
Human Description:
minichromosome maintenance complex component 2 [Source:HGNC Symbol;Acc:6944]
Mouse Orthologue:
Mcm2
Mouse Description:
minichromosome maintenance deficient 2 mitotin (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:10538

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38176 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38175 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38176
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006598 Essential Splice Site 122 884 3 22
ENSDART00000049626 Essential Splice Site 122 889 3 16
ENSDART00000114363 Essential Splice Site 122 876 3 20
Genomic Location (Zv9):
Chromosome Zv9_NA237 (position 29574)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5621712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAACAAGGCCTTGGCATGGGCCGCATCGGACGTGGACTCCTTTACGG[T/C]AGGTGGTTAAATCCAGTGAATTTTATTTTAATGTATTGATTATAGTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38175
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006598 Nonsense 532 884 16 22
ENSDART00000049626 Nonsense 537 889 10 16
ENSDART00000114363 Nonsense 524 876 14 20
Genomic Location (Zv9):
Chromosome Zv9_NA237 (position 17958)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5610526
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGAAGTACGTGGAGAAGGTGGCGAGTCGAGCGGTGTTCACCACAGGA[C/T]AGGGAGCCTCCGCTGTGGGTCTGACGGCTTACGTGCAGCGGCATCCCGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link