dcbld1

Ensembl ID:
ENSDARG00000015907
ZFIN ID:
ZDB-GENE-050913-77
Description:
discoidin, CUB and LCCL domain containing 1 [Source:RefSeq peptide;Acc:NP_001035066]
Human Orthologue:
DCBLD1
Human Description:
discoidin, CUB and LCCL domain containing 1 [Source:HGNC Symbol;Acc:21479]
Mouse Orthologue:
Dcbld1
Mouse Description:
discoidin, CUB and LCCL domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1913936]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37130 Nonsense Mutation detected in F1 DNA During 2017
sa23788 Nonsense Available for shipment Available now
sa43512 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9772 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37130
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015801 Nonsense 110 703 3 15
ENSDART00000099305 Nonsense 110 263 3 6
ENSDART00000138640   None 445 None 8
ENSDART00000139912 Nonsense 110 289 3 5
ENSDART00000143993 Nonsense 85 207 2 5
Genomic Location (Zv9):
Chromosome 20 (position 42391429)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42462588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTCATTTCTCCTAGTGTACTGGGAGTACTGTGGTGATCCAATGCCC[A/T]AGCCCTCACAGCTTCACACAGACTCCAATGAGCTGACCATTCGCTTTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23788
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015801 Nonsense 113 703 3 15
ENSDART00000099305 Nonsense 113 263 3 6
ENSDART00000138640   None 445 None 8
ENSDART00000139912 Nonsense 113 289 3 5
ENSDART00000143993 Nonsense 88 207 2 5
Genomic Location (Zv9):
Chromosome 20 (position 42391420)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42462579
KASP Assay ID:
2261-4816.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCCTAGTGTACTGGGAGTACTGTGGTGATCCAATGCCCAAGCCCTCA[C/T]AGCTTCACACAGACTCCAATGAGCTGACCATTCGCTTTCGCAGCAGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43512
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015801 Essential Splice Site 349 703 10 15
ENSDART00000099305   None 263 None 6
ENSDART00000138640 Essential Splice Site 103 445 3 8
ENSDART00000139912   None 289 None 5
ENSDART00000143993   None 207 None 5
Genomic Location (Zv9):
Chromosome 20 (position 42340895)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42412054
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTTGTCATTCATCTGTTTTAATTGTTCATTGTTGTATTTTTCCTCA[G/A]GTTTTTGAAGGAAACACTAACAGCCTCCACCAAACGCGCAACACCTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9772
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015801 Nonsense 613 703 15 15
ENSDART00000099305   None 263 None 6
ENSDART00000138640 Nonsense 355 445 8 8
ENSDART00000139912   None 289 None 5
ENSDART00000143993   None 207 None 5
Genomic Location (Zv9):
Chromosome 20 (position 42331692)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42402851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGTGCTAAACAAAARCCCATCGTTTCGGGCAGTCGAAGGCGGGAACTG[T/A]AGGAAAGTGATYGGAGGGCTGGCCGGGGGCTACCAAACACCTCAAGTAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link