lztr1

Ensembl ID:
ENSDARG00000015905
ZFIN ID:
ZDB-GENE-030131-9564
Description:
leucine-zipper-like transcription regulator 1 [Source:RefSeq peptide;Acc:NP_001074074]
Human Orthologue:
LZTR1
Human Description:
leucine-zipper-like transcription regulator 1 [Source:HGNC Symbol;Acc:6742]
Mouse Orthologue:
Lztr1
Mouse Description:
leucine-zipper-like transcriptional regulator, 1 Gene [Source:MGI Symbol;Acc:MGI:1914113]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20355 Nonsense Mutation detected in F1 DNA During 2016
sa40365 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20355
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055887 Nonsense 347 776 10 20
ENSDART00000137705 Nonsense 351 780 10 20
Genomic Location:
Chromosome 5 (position 13937613)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACATCTTTGGAGGAACAGTTGACAATAATGTACGCAGTGGAGAAATGTA[C/A]AGATTCCAGGTGAGTGCTTGATGTTTAGAAATGCACCTGCTTTATCTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055887 Essential Splice Site 738 776 19 20
ENSDART00000137705 Essential Splice Site 742 780 19 20
Genomic Location:
Chromosome 5 (position 13928246)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACATGAAGAAACACTGCCTGCATATTATAGTGCATCAGTTCACCAAG[G/A]TGGGTGTGCTACTGACCACAGCTCTAAGCGTGTGCTGGTTACCTCGACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link