LOC567443

Ensembl ID:
ENSDARG00000015891
Human Orthologue:
PTPRE
Human Description:
protein tyrosine phosphatase, receptor type, E [Source:HGNC Symbol;Acc:9669]
Mouse Orthologue:
Ptpre
Mouse Description:
protein tyrosine phosphatase, receptor type, E Gene [Source:MGI Symbol;Acc:MGI:97813]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38906 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9616 Nonsense Available for shipment Available now
sa9880 Nonsense Available for shipment Available now
sa5604 Nonsense F2 line generated During 2016
sa2648 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa38906
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004122 Essential Splice Site 322 681 10 19
Genomic Location (Zv9):
Chromosome 12 (position 45262208)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 43338464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAGCAGGTGAACCCGTCGTACGCCGGACCCATCGTCGTGCACTGCAG[G/A]TTTGGCTTCATGTGCTCTTAATGCAGGATAAATATAGAGCTGTGTGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9616
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004122 Nonsense 359 681 11 19
ENSDART00000004122 Nonsense 359 681 11 19
Genomic Location (Zv9):
Chromosome 12 (position 45256279)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 43332535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACGGAGCAGAAGGTGGACGTGTTCGGGTTYGTGTCCCGCATCCGTGAA[C/T]AGAGATCTCAGCTCATCCAGACAGACGTGAGGGCGCTTCTCTGTTCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9880
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004122 Nonsense 359 681 11 19
ENSDART00000004122 Nonsense 359 681 11 19
Genomic Location (Zv9):
Chromosome 12 (position 45256279)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 43332535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACGGAGCAGAAGGTGGACGTGTTCGGGTTYGTGTCCCGCATCCGTGAA[C/T]AGAGATCTCAGCTCATCCAGACAGACGTGAGGGCGCTTCTCTGTTCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5604
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004122 Nonsense 599 681 17 19
ENSDART00000004122 Nonsense 599 681 17 19
Genomic Location (Zv9):
Chromosome 12 (position 45242476)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 43318732
KASP Assay ID:
554-3050.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCGAAGGTAAAGGGATGATCGACATCATCGCAGCGGTTCAGAAACAG[C/T]AGCAGCAGTCGGGAAACCACCCCATCATTGTGYACTGCAGGTACAACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2648
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004122 Nonsense 599 681 17 19
ENSDART00000004122 Nonsense 599 681 17 19
Genomic Location (Zv9):
Chromosome 12 (position 45242476)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 43318732
KASP Assay ID:
554-3050.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCGAAGGTAAAGGGATGATCGACATCATCGCAGCGGTTCAGAAACAG[C/T]AGCAGCAGTCGGGAAACCACCCCATCATTGTGYACTGCAGGTACAACACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link