maf

Ensembl ID:
ENSDARG00000015890
ZFIN ID:
ZDB-GENE-010605-2
Description:
transcription factor Maf [Source:RefSeq peptide;Acc:NP_571919]
Human Orthologue:
MAF
Human Description:
v-maf musculoaponeurotic fibrosarcoma oncogene homolog (avian) [Source:HGNC Symbol;Acc:6776]
Mouse Orthologue:
Maf
Mouse Description:
avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene homolog Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4755 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4755
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014703 Nonsense 250 325 1 1
ENSDART00000127651 Nonsense 250 333 1 2
Genomic Location:
Chromosome 18 (position 29353253)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAAGAGGAGGTGATCCGGCTCAAACAGAAGAGAAGAACCCTCAAAAAC[A/T]GAGGCTATGCCCAGTCGTGTCGCTACAAGAGGGTCCAGCAGAGGCACATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Genetic variants that affect length/height in infancy/early childhood in Vietnamese-Korean families. (View Study)
  • Multiple sclerosis: Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis. (View Study)
  • Obesity: Genome-wide association study for early-onset and morbid adult obesity identifies three new risk loci in European populations. (View Study)
  • Renal function-related traits (urea): Meta-analysis identifies multiple loci associated with kidney function-related traits in east Asian populations. (View Study)
  • Thyroid function: Meta-analysis of two genome-wide association studies identifies four genetic loci associated with thyroid function. (View Study)
  • Thyroid hormone levels: A meta-analysis of thyroid-related traits reveals novel loci and gender-specific differences in the regulation of thyroid function. (View Study)
  • Thyroid volume: Genome-wide association study identifies four genetic loci associated with thyroid volume and goiter risk. (View Study)
  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hckmclj6