pax8

Ensembl ID:
ENSDARG00000015879
ZFIN ID:
ZDB-GENE-001030-3
Description:
Transcription factor [Source:UniProtKB/TrEMBL;Acc:O93372]
Human Orthologue:
PAX8
Human Description:
paired box 8 [Source:HGNC Symbol;Acc:8622]
Mouse Orthologue:
Pax8
Mouse Description:
paired box gene 8 Gene [Source:MGI Symbol;Acc:MGI:97492]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2216 Nonsense F2 line generated During 2017
sa31494 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2216
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029014 Nonsense 46 429 2 10
Genomic Location (Zv9):
Chromosome 5 (position 75550765)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 71639432
KASP Assay ID:
554-2744.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCCCCAGTGACTGTACCGCTGTCCCTGTGTGTTCTCATTCAGGTACTA[T/G]GAGACGGGCAGCATCAAACCCGGCGTCATCGGCGGCTCCAAGCCCAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029014 Nonsense 253 429 6 10
Genomic Location (Zv9):
Chromosome 5 (position 75549221)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 71637888
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTCATGAACCCCGGTCTGGACGAGGGAAAAGGAGCTTCATCCATCAGC[A/T]GAAACCTGGCGGCACATCAGGGCTACGCTGTGGTCACAGGTAAGAACTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link