npas3b

Ensembl ID:
ENSDARG00000015876
ZFIN ID:
ZDB-GENE-060503-934
Description:
Novel protein similar to vertebrate neuronal PAS domain family [Source:UniProtKB/TrEMBL;Acc:Q1LXP7]
Human Orthologue:
NPAS1
Human Description:
neuronal PAS domain protein 1 [Source:HGNC Symbol;Acc:7894]
Mouse Orthologue:
Npas1
Mouse Description:
neuronal PAS domain protein 1 Gene [Source:MGI Symbol;Acc:MGI:109205]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6365 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101511 Nonsense 551 770 11 11
ENSDART00000140213   None 448 None 10
Genomic Location (Zv9):
Chromosome 15 (position 8501303)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 8450810
KASP Assay ID:
554-4528.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCACAATCCCTCCAGCAAACGGGTGAAGAATGAAGAGGGGGCTTCAAAA[C/T]AAGGCAACGGGGCTAACGGAGCAGGTAAGATCCACAATGGCCGTGCTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link