mtmr9

Ensembl ID:
ENSDARG00000015860
ZFIN ID:
ZDB-GENE-040724-223
Description:
myotubularin-related protein 9 [Source:RefSeq peptide;Acc:NP_001038535]
Human Orthologue:
MTMR9
Human Description:
myotubularin related protein 9 [Source:HGNC Symbol;Acc:14596]
Mouse Orthologue:
Mtmr9
Mouse Description:
myotubularin related protein 9 Gene [Source:MGI Symbol;Acc:MGI:2442842]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9609 Essential Splice Site Available for shipment Available now
sa6627 Nonsense Mutation detected in F1 DNA During 2014
sa16766 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9609
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035447 Essential Splice Site 98 549 3 10
Genomic Location:
Chromosome 20 (position 19028840)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTGATCARTGTAGGCTGTCAGTGTTTAYGTTATGAGGATCTCTCCTCC[A/T]GGCTCTGTCCACGCTGGACTCTGTGTCWCTGATGTACCCRTTCTTCTAYC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6627
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035447 Nonsense 288 549 6 10
Genomic Location:
Chromosome 20 (position 19033936)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAACATCCTGCAGGAGAGCCTGATAAAGCTGGTGGAGGCCTGCAATGAT[C/T]AGTCTCACAACATGGACCGCTGGCTCAGTAAACTCGAGGCCTCCAACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16766
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035447 Nonsense 427 549 8 10
Genomic Location:
Chromosome 20 (position 19041032)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTYCCTTGCTCATTTCAGTTCAGCGAGAGCTTTCTCATCATGCTYTTC[G/T]AGCACACCTATGCCTCACAGTTTGGCACTTTCCTCGGCAACAGTGTGGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j5pir3bf