chat

Ensembl ID:
ENSDARG00000015854
ZFIN ID:
ZDB-GENE-080102-2
Description:
Choline O-acetyltransferase [Source:UniProtKB/Swiss-Prot;Acc:B2ZGJ1]
Human Orthologue:
CHAT
Human Description:
choline O-acetyltransferase [Source:HGNC Symbol;Acc:1912]
Mouse Orthologue:
Chat
Mouse Description:
choline acetyltransferase Gene [Source:MGI Symbol;Acc:MGI:88392]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45487 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22323 Nonsense Available for shipment Available now
sa31935 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024225 Essential Splice Site 16 637 1 14
ENSDART00000024225 Essential Splice Site 16 637 1 14
Genomic Location (Zv9):
Chromosome 13 (position 29644375)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGCCAGTTTCAAAAAGGGAACAATCAAAGGACACGGGAGATCCATGT[G/A]TAAGCAAAACCCATTTTGCATGTAAAATGTGACTAAAATTTATTGCGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22323
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024225 Nonsense 91 637 3 14
Genomic Location (Zv9):
Chromosome 13 (position 29642944)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29288892
GRCz11 13 29419342
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGATCATTGTGTTAGGTGTATGATTATTGGCTTGAAGACATGTATT[T/A]GAACAACAGGTTAGCACTACCTGTCAACTCCAGTCCTGTTATGGTCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31935
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024225 Nonsense 248 637 6 14
Genomic Location (Zv9):
Chromosome 13 (position 29640656)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29286604
GRCz11 13 29417054
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGCGTCAGCCTCCAATCGGCCTGCTCACATCAGATGGCAGAACACAGT[G/A]GGCCGAGGCTCGCAACATACTGATCAAAGGTCAGACATCATTTATTCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link