pnn

Ensembl ID:
ENSDARG00000015851
ZFIN ID:
ZDB-GENE-060519-3
Description:
pinin, desmosome associated protein [Source:RefSeq peptide;Acc:NP_001166041]
Human Orthologue:
PNN
Human Description:
pinin, desmosome associated protein [Source:HGNC Symbol;Acc:9162]
Mouse Orthologue:
Pnn
Mouse Description:
pinin Gene [Source:MGI Symbol;Acc:MGI:1100514]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23019 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23019
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012670 Essential Splice Site 47 676 1 9
Genomic Location (Zv9):
Chromosome 17 (position 12963031)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 13089195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACGAGAATATTCGAAAACTAACCGGCAGAGATCCGGGTGAATTAAGG[T/C]ATTGCTTAATGAACGCGTTTTAATCATTAACGAATTTGTTGTGGAGAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link