dnajb1a

Ensembl ID:
ENSDARG00000015831
ZFIN ID:
ZDB-GENE-040801-90
Description:
DnaJ (Hsp40) homolog, subfamily B, member 1a [Source:RefSeq peptide;Acc:NP_001003571]
Human Orthologue:
DNAJB1
Human Description:
DnaJ (Hsp40) homolog, subfamily B, member 1 [Source:HGNC Symbol;Acc:5270]
Mouse Orthologue:
Dnajb1
Mouse Description:
DnaJ (Hsp40) homolog, subfamily B, member 1 Gene [Source:MGI Symbol;Acc:MGI:1931874]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20136 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20136
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002225 Essential Splice Site 259 335 2 3
Genomic Location (Zv9):
Chromosome 3 (position 50314025)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 45008445
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGAGACGGCTCTGACATCATCTACCCTGCAAGGATATCCCTCAGAGAG[G/A]TGGGTGTTTAGTGTCTGCTGCTCAGATAAAGTTACTGATGCTTCAGTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link