mov10a

Ensembl ID:
ENSDARG00000015829
ZFIN ID:
ZDB-GENE-091230-8
Human Orthologue:
MOV10
Human Description:
Mov10, Moloney leukemia virus 10, homolog (mouse) [Source:HGNC Symbol;Acc:7200]
Mouse Orthologue:
Mov10
Mouse Description:
Moloney leukemia virus 10 Gene [Source:MGI Symbol;Acc:MGI:97054]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2328 Essential Splice Site F2 line generated During 2014
sa11006 Essential Splice Site Available for shipment Available now
sa18853 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2328
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064826 Essential Splice Site 451 1001 8 22
Genomic Location:
Chromosome 6 (position 48296455)
KASP Assay ID:
554-3441.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTCCATCGTGTAGAACTTGACAAAGTTATACTTRGCTTCTCTAGAAAG[T/C]AAGAAACATGCAATATTACACACTGTTAAAGGGTTAGTTCACTCAAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11006
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064826 Essential Splice Site 983 1001 21 22
ENSDART00000064826 Essential Splice Site 983 1001 21 22
Genomic Location:
Chromosome 6 (position 48313771)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAGGATGTGGTCTCACGGCTGGCGTCTTTAAAAATCAGCTCAGATGG[T/C]ACGGAGCATTGCATAACACATCAAGCGTGACTGYATCATATGACTCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18853
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064826 Essential Splice Site 983 1001 21 22
ENSDART00000064826 Essential Splice Site 983 1001 21 22
Genomic Location:
Chromosome 6 (position 48313771)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAGGATGTGGTCTCACGGCTGGCGTCTTTAAAAATCAGCTCAGATGG[T/C]ACGGAGCATTGCATAACACATCAAGCGTGACTGTATCATATGACTCATTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q96uu6r8