lemd3

Ensembl ID:
ENSDARG00000015824
ZFIN ID:
ZDB-GENE-030131-490
Description:
inner nuclear membrane protein Man1 [Source:RefSeq peptide;Acc:NP_001038329]
Human Orthologue:
LEMD3
Human Description:
LEM domain containing 3 [Source:HGNC Symbol;Acc:28887]
Mouse Orthologue:
Lemd3
Mouse Description:
LEM domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:3580376]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40250 Nonsense Mutation detected in F1 DNA During 2017
sa31386 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa40250
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013604 Nonsense 326 841 1 13
ENSDART00000108552 Nonsense 297 812 2 14
Genomic Location (Zv9):
Chromosome 4 (position 11993556)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12930183
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTCTTTCCATAGGAATCACCTCGACAATGGAGACGGCGAATCCGCCTG[C/A]AGCAGCCGGTTCAGCATCGGTCTCAGACCACGCTTTCCTTCCTACACCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31386
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013604 Essential Splice Site 445 841 2 13
ENSDART00000108552 Essential Splice Site 416 812 3 14
Genomic Location (Zv9):
Chromosome 4 (position 11989108)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12925735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTCAGTCATGCAGCATCCATTCGGAGCTGAGTTTGATAAGCAGTATG[T/G]AAGTATCTGTCCTGTGTTTTAATCTTGCATTGAAAAATGGATGAATAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link