sesn3

Ensembl ID:
ENSDARG00000015822
ZFIN ID:
ZDB-GENE-040426-2924
Description:
sestrin-3 [Source:RefSeq peptide;Acc:NP_998684]
Human Orthologue:
SESN3
Human Description:
sestrin 3 [Source:HGNC Symbol;Acc:23060]
Mouse Orthologue:
Sesn3
Mouse Description:
sestrin 3 Gene [Source:MGI Symbol;Acc:MGI:1922997]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42597 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086954 Nonsense 354 466 8 10
Genomic Location (Zv9):
Chromosome 15 (position 34374928)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35220704
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTAACCGGTTGTACTCTGACATCGGGCACCTGCTGGATGATAAGTTC[A/T]GAACGGCCTGTGATTTGACGTATTATAACATGGCCAGTCATGAGGGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link