kdrl

Ensembl ID:
ENSDARG00000015815
ZFIN ID:
ZDB-GENE-000705-1
Description:
Vascular endothelial growth factor receptor kdr-like [Source:UniProtKB/Swiss-Prot;Acc:Q8AXB3]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28333 Nonsense Mutation detected in F1 DNA During 2017
sa19086 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9469 Essential Splice Site Available for shipment Available now
sa44811 Essential Splice Site Mutation detected in F1 DNA During 2017
sa15912 Nonsense Available for shipment Available now
sa44810 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007819 Nonsense 411 1301 9 30
Genomic Location (Zv9):
Chromosome 14 (position 33878842)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 32683455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTATCGCTCTGTCAAACCAGGAGAGGGGTCTCTACAGAAACATCAGTTA[C/A]AAGCTTGAAGTCAGAGGTAATGCCGTGAAAAACAATAAGAACAGCACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007819 Essential Splice Site 469 1301 10 30
ENSDART00000007819 Essential Splice Site 469 1301 10 30
Genomic Location (Zv9):
Chromosome 14 (position 33876491)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 32681104
KASP Assay ID:
2260-7725.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTACCTGGTTTTGGCAGCCATGTGACCCCAGTGCTAATCTTACAGAG[T/C]AGGTCAATCAATGTTCACATTTACTGTTTATTTTCTGATTTCATATGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9469
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007819 Essential Splice Site 469 1301 10 30
ENSDART00000007819 Essential Splice Site 469 1301 10 30
Genomic Location (Zv9):
Chromosome 14 (position 33876491)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 32681104
KASP Assay ID:
2260-7725.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTACCTGGTTTTGGCAGCCRTGTGACCCCAGTGCTAATCTTACAGAG[T/C]AGGTCAATCAATGTTCACATTTACTGTTTATTTTCTGATTTCATATGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44811
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007819 Essential Splice Site 638 1301 13 30
Genomic Location (Zv9):
Chromosome 14 (position 33869236)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAACACCAATAAAGTGGTCAATGTAACATCTGCTTTGACTATTGATGG[T/C]GAGTTTTATATATCAAGCGCCAAACAGATTTGTAAACAGAGTTGTCTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007819 Nonsense 784 1301 17 30
Genomic Location (Zv9):
Chromosome 14 (position 33866464)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 32671077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCAGCAGATTTRAAGACAGGGTACCTGTCCATCAWCATGGATCCTGAA[C/T]AGATGCCTCTCGATGAGCAGTGTGACCGTCTACCATATGACAGCAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44810
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007819 Essential Splice Site 884 1301 19 30
Genomic Location (Zv9):
Chromosome 14 (position 33862532)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCATCTCAATGTGGTTAACCTGCTAGGAGCCTGCACAAAGCGTGGCGG[T/C]AAGAGGAGGATGATAAGATTAGACATTCAACTTTTTCTCTGCTCAGTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link