kdrl

Ensembl ID:
ENSDARG00000015815
ZFIN ID:
ZDB-GENE-000705-1
Description:
Vascular endothelial growth factor receptor kdr-like [Source:UniProtKB/Swiss-Prot;Acc:Q8AXB3]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19086 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9469 Essential Splice Site Available for shipment Available now
sa15912 Nonsense Available for shipment Available now
sa2782 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007819 Essential Splice Site 469 1301 10 30
ENSDART00000007819 Essential Splice Site 469 1301 10 30
Genomic Location:
Chromosome 14 (position 33876491)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTACCTGGTTTTGGCAGCCATGTGACCCCAGTGCTAATCTTACAGAG[T/C]AGGTCAATCAATGTTCACATTTACTGTTTATTTTCTGATTTCATATGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9469
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007819 Essential Splice Site 469 1301 10 30
ENSDART00000007819 Essential Splice Site 469 1301 10 30
Genomic Location:
Chromosome 14 (position 33876491)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTACCTGGTTTTGGCAGCCRTGTGACCCCAGTGCTAATCTTACAGAG[T/C]AGGTCAATCAATGTTCACATTTACTGTTTATTTTCTGATTTCATATGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007819 Nonsense 784 1301 17 30
Genomic Location:
Chromosome 14 (position 33866464)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCAGCAGATTTRAAGACAGGGTACCTGTCCATCAWCATGGATCCTGAA[C/T]AGATGCCTCTCGATGAGCAGTGTGACCGTCTACCATATGACAGCAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2782
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007819 Nonsense 1070 1301 24 30
Genomic Location:
Chromosome 14 (position 33860258)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATCTATACTACTCARAGTGACGTGTGGTCTTTTGGAGTGCTTATGTG[G/A]GAGATCTTCTCTCTTGGTAAATGGCACTGCTGTCCTAAGAGTGTAACTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ft4r10yu