rab22a

Ensembl ID:
ENSDARG00000015807
ZFIN ID:
ZDB-GENE-041114-161
Description:
ras-related protein Rab-22A [Source:RefSeq peptide;Acc:NP_991282]
Human Orthologue:
RAB22A
Human Description:
RAB22A, member RAS oncogene family [Source:HGNC Symbol;Acc:9764]
Mouse Orthologue:
Rab22a
Mouse Description:
RAB22A, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:105072]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5387 Nonsense F2 line generated During 2017
sa7049 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5387
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022581 Nonsense 59 196 3 7

The following transcripts of ENSDARG00000015807 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 49508512)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 49558193
KASP Assay ID:
554-3544.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACAAAGACTGTGCAATACCAAAAYGAGCTTCACAAATTCCTCATCTG[G/A]GACACAGCAGGACAAGAAAGGGTAAACAGTAACAATCACTACACACACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022581 Essential Splice Site 90 196 None 7

The following transcripts of ENSDARG00000015807 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 49518311)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 49567992
KASP Assay ID:
554-4107.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACAGAGGCTCTGCTGCGGCCATCATCGTCTATGACATCACTAAAGAGG[T/A]ACTGAAACATTTCTTCGTTATTACCACACAAATCTTTCTTCTGGTAAAGM
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link