cgnl1

Ensembl ID:
ENSDARG00000015805
ZFIN ID:
ZDB-GENE-071009-2
Description:
Cgnl1 protein [Source:UniProtKB/TrEMBL;Acc:Q58ED4]
Human Orthologue:
CGNL1
Human Description:
cingulin-like 1 [Source:HGNC Symbol;Acc:25931]
Mouse Orthologue:
Cgnl1
Mouse Description:
cingulin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1915428]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21073 Nonsense Available for shipment Available now
sa41023 Nonsense Mutation detected in F1 DNA During 2016
sa11664 Nonsense Available for shipment Available now
sa15287 Nonsense Available for shipment Available now
sa41022 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa21073
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052039   None 486 None 11
ENSDART00000129769 Nonsense 208 1214 2 19
Genomic Location (Zv9):
Chromosome 7 (position 53948639)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52218489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGCCTTCCAGTTCCTCAGCCATCTACAGTAGCCAGCAAGCCCAGTGAC[C/T]AGACCAGGGCTTTGTCTAGACCTCCTAGCTCAGTGAGTAGTGCCAACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052039   None 486 None 11
ENSDART00000129769 Nonsense 238 1214 2 19
Genomic Location (Zv9):
Chromosome 7 (position 53948548)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52218398
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAACTCCAGTCTGGAACGAAGCCGTCGTGAGCCGGATGTGCTGCCCT[T/G]ACGCCGATTTGACTCCAGTGGCCCTGTGCTACAGACTTCTTCCTCCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11664
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052039 Nonsense 162 486 5 11
ENSDART00000129769 Nonsense 609 1214 6 19
Genomic Location (Zv9):
Chromosome 7 (position 53943444)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52213294
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGAGCTGGAGTRAAAGACTTGAGGAGAGAGCTGGAGCAGAGTCAAGCY[G/T]AGTGCAGTAGACTGAGGGAMAAGCTGAKTAAAACAGAGGCTGACCTGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15287
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052039 Nonsense 318 486 8 11
ENSDART00000129769 Nonsense 775 1214 10 19
Genomic Location (Zv9):
Chromosome 7 (position 53917847)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52187697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACCATGTTACAGCCAATAAGGAGAAAGAGGAAGTGGAAGCAGCACGA[A/T]AGGTTTCTGAGAGCCAGACAAGCCGTCTGTCTCAGGAGATTGARAGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052039   None 486 None 11
ENSDART00000129769 Essential Splice Site 1123 1214 18 19
Genomic Location (Zv9):
Chromosome 7 (position 53893190)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52163040
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAATGTATGATTTAAACAAAAAGAGTTAAATTTGAAGATGACTTTTTAC[A/C]GGGATCGAGCTAACCTGCAGCTGGCAAATCGACGTCTTGAGCGGAAGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link