cgnl1

Ensembl ID:
ENSDARG00000015805
ZFIN ID:
ZDB-GENE-071009-2
Description:
Cgnl1 protein [Source:UniProtKB/TrEMBL;Acc:Q58ED4]
Human Orthologue:
CGNL1
Human Description:
cingulin-like 1 [Source:HGNC Symbol;Acc:25931]
Mouse Orthologue:
Cgnl1
Mouse Description:
cingulin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1915428]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21073 Nonsense Available for shipment Available now
sa11664 Nonsense Available for shipment Available now
sa15287 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21073
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052039 None None 486 None 11
ENSDART00000129769 Nonsense 208 1214 2 19
Genomic Location:
Chromosome 7 (position 53948639)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGCCTTCCAGTTCCTCAGCCATCTACAGTAGCCAGCAAGCCCAGTGAC[C/T]AGACCAGGGCTTTGTCTAGACCTCCTAGCTCAGTGAGTAGTGCCAACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11664
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052039 Nonsense 162 486 5 11
ENSDART00000129769 Nonsense 609 1214 6 19
Genomic Location:
Chromosome 7 (position 53943444)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGAGCTGGAGTRAAAGACTTGAGGAGAGAGCTGGAGCAGAGTCAAGCY[G/T]AGTGCAGTAGACTGAGGGAMAAGCTGAKTAAAACAGAGGCTGACCTGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15287
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052039 Nonsense 318 486 8 11
ENSDART00000129769 Nonsense 775 1214 10 19
Genomic Location:
Chromosome 7 (position 53917847)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAACCATGTTACAGCCAATAAGGAGAAAGAGGAAGTGGAAGCAGCACGA[A/T]AGGTTTCTGAGAGCCAGACAAGCCGTCTGTCTCAGGAGATTGARAGACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pftmcavg