mmp13b

Ensembl ID:
ENSDARG00000015797
ZFIN ID:
ZDB-GENE-030131-6152
Human Orthologue:
MMP13
Human Description:
matrix metallopeptidase 13 (collagenase 3) [Source:HGNC Symbol;Acc:7159]
Mouse Orthologue:
Mmp13
Mouse Description:
matrix metallopeptidase 13 Gene [Source:MGI Symbol;Acc:MGI:1340026]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa562 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa562
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033206 Essential Splice Site 164 464 3 10
Genomic Location:
Chromosome 15 (position 32042936)
KASP Assay ID:
554-0472.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAACGTTTGATGGAACTGCCGACATCATGATCAGCTTTGGAACAAAAG[G/A]TACCACCGTTTGTGTCATTTATGCAGGATTCACTGCAGGGTGTTTATCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9ab61kdd