mmp13b

Ensembl ID:
ENSDARG00000015797
ZFIN ID:
ZDB-GENE-030131-6152
Human Orthologue:
MMP13
Human Description:
matrix metallopeptidase 13 (collagenase 3) [Source:HGNC Symbol;Acc:7159]
Mouse Orthologue:
Mmp13
Mouse Description:
matrix metallopeptidase 13 Gene [Source:MGI Symbol;Acc:MGI:1340026]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa562 Essential Splice Site Available for shipment Available now
sa35941 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa562
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033206 Essential Splice Site 164 464 3 10
Genomic Location (Zv9):
Chromosome 15 (position 32042936)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33973611
KASP Assay ID:
554-0472.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAACGTTTGATGGAACTGCCGACATCATGATCAGCTTTGGAACAAAAG[G/A]TACCACCGTTTGTGTCATTTATGCAGGATTCACTGCAGGGTGTTTATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35941
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033206 Nonsense 434 464 10 10
Genomic Location (Zv9):
Chromosome 15 (position 32047923)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 33968624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCAATGCATGAATGTTAATAACTGTTTGTATTTTTTAACAGGATACT[T/A]GAACTTGTATCATGAACATACTCAGTTTGAGTACAGTTACAGCGCAAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link