aarsd1

Ensembl ID:
ENSDARG00000015747
ZFIN ID:
ZDB-GENE-040801-91
Description:
Alanyl-tRNA editing protein Aarsd1 [Source:UniProtKB/Swiss-Prot;Acc:Q6DEJ5]
Human Orthologue:
AARSD1
Human Description:
alanyl-tRNA synthetase domain containing 1 [Source:HGNC Symbol;Acc:28417]
Mouse Orthologue:
Aarsd1
Mouse Description:
alanyl-tRNA synthetase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1916934]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18183 Nonsense Available for shipment Available now
sa41961 Essential Splice Site Mutation detected in F1 DNA During 2016
sa3815 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18183
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002583 Nonsense 35 412 2 12
Genomic Location:
Chromosome 12 (position 6746180)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGTGTCTTGCGTGCCTGCAGAATTAAAACTKGAGAAWAATGGAAGGAAA[G/T]AGAAGCTGACGGGKTTCAATGTGAAACTRAAAGACACTATTCTCTTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41961
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002583 Essential Splice Site 220 412 6 12
Genomic Location:
Chromosome 12 (position 6741683)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCCAACATGTGCTGTGGAACTCATGTGTCCAACCTCAGTCACCTTCAG[G/T]TTAGTCTTTCACTGCCTCCTAAAGAGATAGTTCACCCAAAAATGTAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3815
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002583 Essential Splice Site 220 412 6 12
Genomic Location:
Chromosome 12 (position 6741682)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCAACATGTGCTGTGGAACTCATGTGTCCAACCTCAGTCACCTTCAGG[T/C]TAGTCTTTCACTGCCTCCTAAAGAGATAGTTCACCCAMAAATGTAGAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link