aarsd1

Ensembl ID:
ENSDARG00000015747
ZFIN ID:
ZDB-GENE-040801-91
Description:
Alanyl-tRNA editing protein Aarsd1 [Source:UniProtKB/Swiss-Prot;Acc:Q6DEJ5]
Human Orthologue:
AARSD1
Human Description:
alanyl-tRNA synthetase domain containing 1 [Source:HGNC Symbol;Acc:28417]
Mouse Orthologue:
Aarsd1
Mouse Description:
alanyl-tRNA synthetase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1916934]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18183 Nonsense Available for shipment Available now
sa3815 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18183
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002583 Nonsense 35 412 2 12
Genomic Location:
Chromosome 12 (position 6746180)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGTGTCTTGCGTGCCTGCAGAATTAAAACTKGAGAAWAATGGAAGGAAA[G/T]AGAAGCTGACGGGKTTCAATGTGAAACTRAAAGACACTATTCTCTTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3815
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002583 Essential Splice Site 220 412 6 12
Genomic Location:
Chromosome 12 (position 6741682)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCAACATGTGCTGTGGAACTCATGTGTCCAACCTCAGTCACCTTCAGG[T/C]TAGTCTTTCACTGCCTCCTAAAGAGATAGTTCACCCAMAAATGTAGAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0xrhurhw