LOC558687

Ensembl ID:
ENSDARG00000015732

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17400 Essential Splice Site Available for shipment Available now
sa24651 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17400
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017043 Essential Splice Site 102 747 3 20
Genomic Location:
Chromosome 25 (position 19380971)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTGCTGAGAATGAAGTAGAGGCCCAAAAASTGGCAAATAATTATAAGG[T/G]RAATATAGGATATGGTGTTTGGTTTATTAYTACACGTTWATTATGCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24651
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017043 Nonsense 471 747 12 20
Genomic Location:
Chromosome 25 (position 19389929)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCTCTCAGGGGATCTGTATGATAATCGGAGGTCTGAAGCACCAGGAG[C/T]AGAGGTTTAACAGTCGCTCGGCAGGAGTCAGTTCCTCTCTGCTCTTCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/noiu5pim