ANO5 (2 of 2)

Ensembl ID:
ENSDARG00000015731
Description:
anoctamin 5 [Source:HGNC Symbol;Acc:27337]
Human Orthologue:
ANO5
Human Description:
anoctamin 5 [Source:HGNC Symbol;Acc:27337]
Mouse Orthologue:
Ano5
Mouse Description:
anoctamin 5 Gene [Source:MGI Symbol;Acc:MGI:3576659]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25238 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa38139 Nonsense Available for shipment Available now
sa24725 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044453 Splice Site, Nonsense 321 915 9 20
Genomic Location (Zv9):
Chromosome 25 (position 36284901)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34718641
KASP Assay ID:
554-7529.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATAAGACGCACACAGGGAATAAACAAAAGTGATTGTCGTCTTCCGCAGT[C/T]GAGAGATCTGCAACGAGACCATCGGTGGGCAGATTGTCATGTGTCCGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38139
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044453 Nonsense 420 915 11 20
Genomic Location (Zv9):
Chromosome 25 (position 36285647)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34719387
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGCAGCTCCAGCTCAGACCCGAATACGAGTCCAAGTGCACCAATCGG[C/T]GACTCAACCGCGTCACACAGGTAAACACATTCATTTTGTGAAGTTTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24725
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044453 Essential Splice Site 451 915 12 20
Genomic Location (Zv9):
Chromosome 25 (position 36290333)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34724073
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAAGTGTGCTCGTTCAATACTGTCTGGGGCCACCGTCCTCTTCTGGG[T/C]GAGCATCAACACTGTCTAGTAGACCACTCTTACACTTTTCATTCTCTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link