flt4

Ensembl ID:
ENSDARG00000015717
ZFIN ID:
ZDB-GENE-980526-326
Description:
Vascular endothelial growth factor receptor 3 [Source:UniProtKB/Swiss-Prot;Acc:Q5MD89]
Human Orthologue:
FLT4
Human Description:
fms-related tyrosine kinase 4 [Source:HGNC Symbol;Acc:3767]
Mouse Orthologue:
Flt4
Mouse Description:
FMS-like tyrosine kinase 4 Gene [Source:MGI Symbol;Acc:MGI:95561]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9798 Nonsense Available for shipment Available now
sa281 Nonsense F2 line generated During 2014
sa16036 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125081 Nonsense 563 1368 12 30
Genomic Location:
Chromosome 14 (position 19773956)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGGCCGTGTGGTTATWCAGAATGCCAGTGTGCCAGCTATGTACAAGTGCT[T/A]GGCTGAGAACAAAGTGGGAAAAGATGAACGACTGATTTATTTCTACGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa281
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125081 Nonsense 593 1368 13 30
Genomic Location:
Chromosome 14 (position 19772144)
KASP Assay ID:
554-2919.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACATTCATTTAGCTATCCCTGAAGGATTCGATATAGAGATGGAGCCCT[C/A]AGAGGATCCGCTTGAGCAGGACCTGGTRCAGCTGAAGTGTAATGCAGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16036
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125081 Nonsense 1088 1368 24 30
Genomic Location:
Chromosome 14 (position 19733259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATAGGTGAAGTGTTATCTGTCTTTGCAGGCYAGGCTGCCGCTGAAGTG[G/A]ATGGCTCCAGAGAGCATCTTTGATAARGTTTACACCAGTCAGAGTGACGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4gmz5w6n