flt4

Ensembl ID:
ENSDARG00000015717
ZFIN ID:
ZDB-GENE-980526-326
Description:
Vascular endothelial growth factor receptor 3 [Source:UniProtKB/Swiss-Prot;Acc:Q5MD89]
Human Orthologue:
FLT4
Human Description:
fms-related tyrosine kinase 4 [Source:HGNC Symbol;Acc:3767]
Mouse Orthologue:
Flt4
Mouse Description:
FMS-like tyrosine kinase 4 Gene [Source:MGI Symbol;Acc:MGI:95561]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42378 Nonsense Mutation detected in F1 DNA During 2016
sa35677 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9798 Nonsense Available for shipment Available now
sa281 Nonsense F2 line generated During 2016
sa35676 Nonsense Mutation detected in F1 DNA During 2016
sa31980 Nonsense Mutation detected in F1 DNA During 2016
sa16036 Nonsense Available for shipment Available now
sa35675 Essential Splice Site Mutation detected in F1 DNA During 2016
sa30675 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125081 Nonsense 86 1368 3 30
Genomic Location:
Chromosome 14 (position 19820163)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTTACTGATCGCCAGGGTCAGCAGTCACCCACTGACACCCCAGGGTA[T/G]AGAGAAATCAGGCTGAAGGAGTGTCAAGGGGTGGCTGGAAAACCCTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35677
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125081 Essential Splice Site 186 1368 4 30
Genomic Location:
Chromosome 14 (position 19804357)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTACCATGTCTGGTTTCAGATCCTGACCTAAAAGTCACTCTCTTCTCGG[T/C]AGGTCTCCAACACGCTTCCAGCAGCAACTCACCTGATCTCTCTGTTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125081 Nonsense 563 1368 12 30
Genomic Location:
Chromosome 14 (position 19773956)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGGCCGTGTGGTTATWCAGAATGCCAGTGTGCCAGCTATGTACAAGTGCT[T/A]GGCTGAGAACAAAGTGGGAAAAGATGAACGACTGATTTATTTCTACGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa281
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125081 Nonsense 593 1368 13 30
Genomic Location:
Chromosome 14 (position 19772144)
KASP Assay ID:
554-2919.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACATTCATTTAGCTATCCCTGAAGGATTCGATATAGAGATGGAGCCCT[C/A]AGAGGATCCGCTTGAGCAGGACCTGGTRCAGCTGAAGTGTAATGCAGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35676
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125081 Nonsense 741 1368 14 30
Genomic Location:
Chromosome 14 (position 19770417)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACACCCTTTCCTCAGCTGTCCTGGTTTAAAGATAACCAACCCCTCCAT[C/T]AGATATCAGGTTAGTCATTCATCACACTTTTCAATACTAACATTTAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125081 Nonsense 1031 1368 22 30
Genomic Location:
Chromosome 14 (position 19736387)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACTCCACTCACAATAGAGGATCTGATATGCTACAGTTTTCAAGTTGCA[C/T]GAGGAATGGAGTTTCTGGCATCTCGTAAGGTAATTTTCAAACATTTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16036
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125081 Nonsense 1088 1368 24 30
Genomic Location:
Chromosome 14 (position 19733259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATAGGTGAAGTGTTATCTGTCTTTGCAGGCYAGGCTGCCGCTGAAGTG[G/A]ATGGCTCCAGAGAGCATCTTTGATAARGTTTACACCAGTCAGAGTGACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35675
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125081 Essential Splice Site 1119 1368 24 30
Genomic Location:
Chromosome 14 (position 19733166)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGACGTCTGGTCTTTTGGAGTTCTGCTCTGGGAGATTTTCTCACTAGG[T/C]AACAGTTAACCGGGGCAGCTGCAATTAACGCAATGGAGCTGATCAATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30675
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125081 Nonsense 1182 1368 26 30
Genomic Location:
Chromosome 14 (position 19729462)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAGAGACCCACATTTCCAGCTCTGGTGGAGATACTTGGAGATCTACTG[C/T]AGGAAAACAGTCTACCAGTGAGAAGATGCACACACACACACACATTGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link