hsd17b12a

Ensembl ID:
ENSDARG00000015709
ZFIN ID:
ZDB-GENE-030131-5628
Description:
Estradiol 17-beta-dehydrogenase 12-A [Source:UniProtKB/Swiss-Prot;Acc:Q6P3L6]
Human Orthologue:
HSD17B12
Human Description:
hydroxysteroid (17-beta) dehydrogenase 12 [Source:HGNC Symbol;Acc:18646]
Mouse Orthologue:
Hsd17b12
Mouse Description:
hydroxysteroid (17-beta) dehydrogenase 12 Gene [Source:MGI Symbol;Acc:MGI:1926967]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3308 Essential Splice Site F2 line generated During 2017
sa32541 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3308
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005299 Essential Splice Site 60 319 1 11

The following transcripts of ENSDARG00000015709 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 31185983)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29753344
KASP Assay ID:
554-3095.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTGGGAAACGGGGACTTACTCTCTCCCAAATTGGGAAAATGGGCAGG[T/G]AAGTTGAACGACATGAGAGCTTGTATTGGCAGATCATGGGTGGGATAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32541
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005299 Nonsense 220 319 9 11

The following transcripts of ENSDARG00000015709 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 31214511)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29781872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATTGTTTTCCTGTCATCTTTTAACAGGCTTTTGTGGACTTCTTCTCA[C/T]GAGGACTTCAAACAGAGTACAAGTGCAAAGGGATCATCATCCAGGTTAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Neuroblastoma: Common variation at 6q16 within HACE1 and LIN28B influences susceptibility to neuroblastoma. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link