dvl3

Ensembl ID:
ENSDARG00000015707
ZFIN ID:
ZDB-GENE-010319-1
Description:
dishevelled, dsh homolog 3 [Source:RefSeq peptide;Acc:NP_571832]
Human Orthologue:
DVL3
Human Description:
dishevelled, dsh homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:3087]
Mouse Orthologue:
Dvl3
Mouse Description:
dishevelled 3, dsh homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:108100]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14810 Essential Splice Site Available for shipment Available now
sa32847 Nonsense Mutation detected in F1 DNA During 2017
sa19682 Nonsense Available for shipment Available now
sa31259 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14810
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097732 Essential Splice Site 158 676 4 15
Genomic Location (Zv9):
Chromosome 2 (position 9517998)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9931281
KASP Assay ID:
2259-1610.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAGAGACAGGGACAGATCGCGGAGGAAACACTCACATGAGCACTCTGG[T/C]ATACCTCATTGTTCTTGTTTTTCCACTACAAACCAACTTTCWTCAGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32847
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097732 Nonsense 439 676 12 15
Genomic Location (Zv9):
Chromosome 2 (position 9496382)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9909665
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGCAATGGCCTGTCCAGACTCGGGATTGGAAGTTCGAGACCGAATGTG[G/A]CTGAAGATCACTATAGCCAATGCTTTCATAGGTCAAGACACATTTTATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19682
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097732 Nonsense 471 676 13 15
Genomic Location (Zv9):
Chromosome 2 (position 9495723)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9909006
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACTGGCTTTTTCATCATGTGGAGGGGTTCACAGATCGCCGTGAAGCA[C/T]GAAAGTATGCCAGCAACCTGTTGAAGGCTGGCTTCATCCGCCACACGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31259
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097732 Nonsense 639 676 15 15
Genomic Location (Zv9):
Chromosome 2 (position 9491678)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9904961
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTGCGGAGCTCTCGGTCTCACAGCTACAGCCTGAAGCAGGGGTCTGCA[C/T]GAGGTGGCCCGGGGTCACCATCCGGCCGACATCTTGCCCACATTCCCCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link