gsk3a

Ensembl ID:
ENSDARG00000015681
ZFIN ID:
ZDB-GENE-990714-3
Description:
glycogen synthase kinase 3 alpha [Source:RefSeq peptide;Acc:NP_571465]
Human Orthologue:
GSK3A
Human Description:
glycogen synthase kinase 3 alpha [Source:HGNC Symbol;Acc:4616]
Mouse Orthologue:
Gsk3a
Mouse Description:
glycogen synthase kinase 3 alpha Gene [Source:MGI Symbol;Acc:MGI:2152453]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42670 Nonsense Mutation detected in F1 DNA During 2017
sa22769 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42670
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024935 Nonsense 36 440 1 10
ENSDART00000111481 Nonsense 36 440 1 11
ENSDART00000138335   None 40 None 4

The following transcripts of ENSDARG00000015681 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 12946537)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 11351780
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAGCCGCTGCAGCCGCCGCCGGATCAGCCGTCGCCGGTGGAAGCTCAT[C/A]AGGAAAGACGGGGGGCGCGCAGGCCTCAGGCGGGAGTTCGTCTGGTTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024935 Essential Splice Site 419 440 None 10
ENSDART00000111481 Essential Splice Site 419 440 None 11
ENSDART00000138335 Essential Splice Site None 40 None 4

The following transcripts of ENSDARG00000015681 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 12987098)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 11392341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTCATTCCTCCACATGCTCGCTCGCAGACGACACCTGCCTCGCACGG[T/C]ACTGATCACACTTACAAACACAGTGCCTTTGATTTACCCTTCATGTCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link