nmd3

Ensembl ID:
ENSDARG00000015676
ZFIN ID:
ZDB-GENE-050320-149
Description:
60S ribosomal export protein NMD3 [Source:UniProtKB/Swiss-Prot;Acc:Q5BLF0]
Human Orthologue:
NMD3
Human Description:
NMD3 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24250]
Mouse Orthologue:
Nmd3
Mouse Description:
NMD3 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2140103]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42466 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42466
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021299 Essential Splice Site 461 505 15 16
Genomic Location (Zv9):
Chromosome 15 (position 1667156)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1707041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCTGGAGGAGGACGAGATGCTGAGGAAGAACATCAACATCTTCAGAGG[T/C]GAGGAGCCGGCAATATTAACCTCTCCTCTATTAATATTCTAACTGTACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link