pla2g12b

Ensembl ID:
ENSDARG00000015662
ZFIN ID:
ZDB-GENE-040426-2771
Description:
group XIIB secretory phospholipase A2-like protein [Source:RefSeq peptide;Acc:NP_998595]
Human Orthologue:
PLA2G12B
Human Description:
phospholipase A2, group XIIB [Source:HGNC Symbol;Acc:18555]
Mouse Orthologue:
Pla2g12b
Mouse Description:
phospholipase A2, group XIIB Gene [Source:MGI Symbol;Acc:MGI:1917086]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa659 Essential Splice Site Confirmed mutation in F2 line During 2014
sa10863 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa659
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128494 Essential Splice Site 197 235 4 4
Genomic Location:
Chromosome 13 (position 4336679)
KASP Assay ID:
554-0567.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAYAAACTGGATGATCTSTGATAACTTTTCCTATTCTTTCTCCTGCAC[A/T]GCATGTGAGACCTTTGCAGACACCATGTACAACACTGTGTGGACTTTGGG
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 5 dpf

Control on top; Mutant below; 5 dpf

zoom

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
yolk
ZFA:0000084
increased size
PATO:0000586
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
yolk
ZFA:0000084
necrotic
PATO:0000647
abnormal
PATO:0000460
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
13:4337401-4337775 4337775 1 3.96 × 10-06 -1.6 -56 pla2g12b ENSDARG00000015662
22:15775701-15776131 15776131 1 3.28 × 10-04 0.9 1 lpl ENSDARG00000087697
10:24804084-24804600 24804084 -1 0.01 1.0 0 slc43a2b ENSDARG00000061120
13:1277330-1277700 1277330 -1 0.02 -1.5 -49 bag2 ENSDARG00000035005
15:20837201-20837500 20837186 -1 0.02 1.7 1 zgc:162608 ENSDARG00000069375

Mutation Details

Allele Name:
sa10863
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128494 Nonsense 210 235 4 4
Genomic Location:
Chromosome 13 (position 4336720)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CYCCTGCACWGCATGTGAGACCTTYGCWGACACCATGTACAACACTGTGT[G/A]GACTTTGGGCTGCAGACCCTTCATGAACGGCCAAAGGGCGTCCTGCTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7up3ka2r