ca15a

Ensembl ID:
ENSDARG00000015654
ZFIN ID:
ZDB-GENE-070424-7
Description:
carbonic anhydrase XV a [Source:RefSeq peptide;Acc:NP_001075158]
Human Orthologue:
CA4
Human Description:
carbonic anhydrase IV [Source:HGNC Symbol;Acc:1375]
Mouse Orthologue:
Car4
Mouse Description:
carbonic anhydrase 4 Gene [Source:MGI Symbol;Acc:MGI:1096574]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5595 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa5595
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008893 Nonsense 50 336 4 9
ENSDART00000130688 Nonsense 5 226 2 7
Genomic Location:
Chromosome 12 (position 5010125)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCTAAAACTTTTTTTTTTTTAATCCTTGAACTAGATTTTACCACCTG[G/A]CCTGAACTTGCTCCACATTACTGCAATGGATCCAGCCAATCTCCTATAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wtl1r8bu