
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ca15a
- Ensembl ID:
- ENSDARG00000015654
- ZFIN ID:
- ZDB-GENE-070424-7
- Description:
- carbonic anhydrase XV a [Source:RefSeq peptide;Acc:NP_001075158]
- Human Orthologue:
- CA4
- Human Description:
- carbonic anhydrase IV [Source:HGNC Symbol;Acc:1375]
- Mouse Orthologue:
- Car4
- Mouse Description:
- carbonic anhydrase 4 Gene [Source:MGI Symbol;Acc:MGI:1096574]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa5595 | Nonsense | F2 line generated | During 2018 |
sa41944 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa5595
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000008893 | Nonsense | 50 | 336 | 4 | 9 |
ENSDART00000130688 | Nonsense | 5 | 226 | 2 | 7 |
- Genomic Location (Zv9):
- Chromosome 12 (position 5010125)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 4292752 GRCz11 12 4329410 - KASP Assay ID:
- 554-3513.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGCTCTAAAACTTTTTTTTTTTTAATCCTTGAACTAGATTTTACCACCTG[G/A]CCTGAACTTGCTCCACATTACTGCAATGGATCCAGCCAATCTCCTATAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41944
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000008893 | Nonsense | 299 | 336 | 9 | 9 |
ENSDART00000130688 | None | 226 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 12 (position 5001387)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 4284014 GRCz11 12 4320672 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCCAGTTCTGAATGTTAACAACTTCAGAGGAGTTCAGCCGCTGAATGGC[A/T]GAGTGGTGACGTCTCAGGTGGAGCAAACCGCGTCACCCACAGCTCCATCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: