tnip1

Ensembl ID:
ENSDARG00000015653
ZFIN ID:
ZDB-GENE-070112-1502
Description:
TNFAIP3-interacting protein 1 [Source:RefSeq peptide;Acc:NP_001073421]
Human Orthologue:
TNIP1
Human Description:
TNFAIP3 interacting protein 1 [Source:HGNC Symbol;Acc:16903]
Mouse Orthologue:
Tnip1
Mouse Description:
TNFAIP3 interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1926194]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15404 Essential Splice Site Available for shipment Available now
sa22553 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15404
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020961 Essential Splice Site 388 652 10 17
ENSDART00000115072 Essential Splice Site 388 653 11 18
Genomic Location:
Chromosome 14 (position 51664820)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACGACAAAAAACTCCTCCTTGCCAAGTCTAAGATCGACAATGTGCAGG[T/C]ACTGATCTCCAGACAGAAACCCATAATCAGTGCTTTTAGGTAGAGAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22553
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020961 Nonsense 544 652 15 17
ENSDART00000115072 Nonsense 545 653 16 18
Genomic Location:
Chromosome 14 (position 51679642)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACAGCGGGAGCTTATGGAGATTTTTGTTTTGGGGTGTTTTGGAGGGG[C/T]AACAGGAAAGGAGGACGTCTGACCCTACGTCTAATGCCCCCAATGGCCCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2g2l2pvk