rap2c

Ensembl ID:
ENSDARG00000015649
ZFIN ID:
ZDB-GENE-041024-1
Description:
ras-related protein Rap-2c [Source:RefSeq peptide;Acc:NP_001007056]
Human Orthologue:
RAP2A
Human Description:
RAP2A, member of RAS oncogene family [Source:HGNC Symbol;Acc:9861]
Mouse Orthologues:
Gm266, Rap2a
Mouse Descriptions:
predicted gene 266 Gene [Source:MGI Symbol;Acc:MGI:2685112]
RAS related protein 2a Gene [Source:MGI Symbol;Acc:MGI:97855]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13896 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13896
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014095 Essential Splice Site None 183 2 3
Genomic Location:
Chromosome 14 (position 31848312)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCACCGCCTGCGTCGTGCAGTGAGCRTCCCGGCCTTACTTTCACTCCAG[G/A]TACCAGAGTTCAAAAGCAAATCAATCWCGCTTTTTAGACYACTCACATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/iavz6d1o