rgs6

Ensembl ID:
ENSDARG00000015627
ZFIN ID:
ZDB-GENE-030131-31
Description:
regulator of G-protein signaling 6 [Source:RefSeq peptide;Acc:NP_001030340]
Human Orthologue:
RGS6
Human Description:
regulator of G-protein signaling 6 [Source:HGNC Symbol;Acc:10002]
Mouse Orthologue:
Rgs6
Mouse Description:
regulator of G-protein signaling 6 Gene [Source:MGI Symbol;Acc:MGI:1354730]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37054 Nonsense Mutation detected in F1 DNA During 2016
sa43460 Nonsense Mutation detected in F1 DNA During 2016
sa37053 Essential Splice Site Mutation detected in F1 DNA During 2016
sa19237 Nonsense Mutation detected in F1 DNA During 2016
sa15520 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37054
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026156 Nonsense 263 464 12 17
ENSDART00000075489 Nonsense 288 489 12 17
ENSDART00000135513 Nonsense 268 469 11 16
Genomic Location (Zv9):
Chromosome 20 (position 28546441)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28617654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTGAATTAAACAACATTAAAATCTTTGTTTTGCAGATTGATGAGCTA[C/A]ACAGAGCAGTATCTTGACTATGACCCTTTTGTGGCAGTACCAGAACCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43460
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026156 Nonsense 352 464 14 17
ENSDART00000075489 Nonsense 377 489 14 17
ENSDART00000135513 Nonsense 357 469 13 16
Genomic Location (Zv9):
Chromosome 20 (position 28540847)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28612060
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCTTTAGATTCTGGTTGGCGGTACAGGATCTGAAGTGTCGCCCCCTG[C/T]AGGAAGTGGCGTCTCGTGCTCAGGAGATCTGGCAGGAGTTTCTTGCCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37053
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026156 Essential Splice Site 401 464 15 17
ENSDART00000075489 Essential Splice Site 426 489 15 17
ENSDART00000135513 Essential Splice Site 406 469 14 16
Genomic Location (Zv9):
Chromosome 20 (position 28539878)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28611091
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCGCCCTGGCTGTGGTTTGACTGTCAGCCTCCAATGTTTTTCTCTTTC[A/G]GGACCACATCTACAAGCTGATGAAGAGTGACAGCTACCCTCGATTCCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026156 Nonsense 414 464 15 17
ENSDART00000075489 Nonsense 439 489 15 17
ENSDART00000135513 Nonsense 419 469 14 16
Genomic Location (Zv9):
Chromosome 20 (position 28539837)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28611050
KASP Assay ID:
2261-4448.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCTTTCAGGACCACATCTACAAGCTGATGAAGAGTGACAGCTACCCT[C/T]GATTCCTGCGCTCCAATGCTTACCAGGACCTCCTGCTGGCCAGAAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15520
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026156 Essential Splice Site 430 464 15 17
ENSDART00000075489 Essential Splice Site 455 489 15 17
ENSDART00000135513 Essential Splice Site 435 469 14 16
Genomic Location (Zv9):
Chromosome 20 (position 28539786)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 28610999
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTCCTGCGCTCCAATGCTTACCAGGACCTCCTGCTGGCCAGAAAGAAG[G/A]TTAGCCGCTCTTTYAAATCTCTTTCTGCTGTGGAGAATAMRTCTGACTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link