rgs6

Ensembl ID:
ENSDARG00000015627
ZFIN ID:
ZDB-GENE-030131-31
Description:
regulator of G-protein signaling 6 [Source:RefSeq peptide;Acc:NP_001030340]
Human Orthologue:
RGS6
Human Description:
regulator of G-protein signaling 6 [Source:HGNC Symbol;Acc:10002]
Mouse Orthologue:
Rgs6
Mouse Description:
regulator of G-protein signaling 6 Gene [Source:MGI Symbol;Acc:MGI:1354730]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19237 Nonsense Mutation detected in F1 DNA During 2014
sa15520 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026156 Nonsense 414 464 15 17
ENSDART00000075489 Nonsense 439 489 15 17
ENSDART00000135513 Nonsense 419 469 14 16
Genomic Location:
Chromosome 20 (position 28539837)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCTTTCAGGACCACATCTACAAGCTGATGAAGAGTGACAGCTACCCT[C/T]GATTCCTGCGCTCCAATGCTTACCAGGACCTCCTGCTGGCCAGAAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15520
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026156 Essential Splice Site 430 464 15 17
ENSDART00000075489 Essential Splice Site 455 489 15 17
ENSDART00000135513 Essential Splice Site 435 469 14 16
Genomic Location:
Chromosome 20 (position 28539786)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTCCTGCGCTCCAATGCTTACCAGGACCTCCTGCTGGCCAGAAAGAAG[G/A]TTAGCCGCTCTTTYAAATCTCTTTCTGCTGTGGAGAATAMRTCTGACTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q0wyat6y