rasl11b

Ensembl ID:
ENSDARG00000015611
ZFIN ID:
ZDB-GENE-040426-793
Description:
Ras-like protein family member 11B [Source:UniProtKB/Swiss-Prot;Acc:Q6P0U3]
Human Orthologue:
RASL11B
Human Description:
RAS-like, family 11, member B [Source:HGNC Symbol;Acc:23804]
Mouse Orthologue:
Rasl11b
Mouse Description:
RAS-like, family 11, member B Gene [Source:MGI Symbol;Acc:MGI:1916189]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23686 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13617 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23686
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015755 Essential Splice Site 38 244 2 4
Genomic Location:
Chromosome 20 (position 23013338)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTAATGTTCTGTGTGCTTTATCGTTAAAATTCTGGTCTTTTTCTTGC[A/T]GCATTGGTGGTTCGTTTCCTCACTAAGCGGTTTATCGGCGACTACGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13617
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015755 Essential Splice Site 57 244 2 4
Genomic Location:
Chromosome 20 (position 23013278)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTYGTTTCCTCACTAAGCGGTTTATCGGMGACTACGAGAGAAACGTTGG[T/G]AAGTTTGTCATCTTTCTAACAAGACAACCGATTTAGGAAKCATTAAACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ewos9zg8