tubgl

Ensembl ID:
ENSDARG00000015610
ZFIN ID:
ZDB-GENE-040426-836
Description:
tubulin gamma-1 chain [Source:RefSeq peptide;Acc:NP_957202]
Human Orthologues:
TUBG1, TUBG2
Human Descriptions:
tubulin, gamma 1 [Source:HGNC Symbol;Acc:12417]
tubulin, gamma 2 [Source:HGNC Symbol;Acc:12419]
Mouse Orthologues:
Tubg1, Tubg2
Mouse Descriptions:
tubulin, gamma 1 Gene [Source:MGI Symbol;Acc:MGI:101834]
tubulin, gamma 2 Gene [Source:MGI Symbol;Acc:MGI:2144208]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20082 Nonsense Mutation detected in F1 DNA During 2014
sa12922 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026701 Nonsense 53 451 2 11
ENSDART00000110716 Nonsense 53 264 2 9
Genomic Location:
Chromosome 3 (position 37076569)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAGAGGAGTTTGCCACTGAAGGCACTGACCGGAAAGATGTCTTCTTCTA[T/A]CAGGTACTCAAATACAGAATGCCAATTATCTACCATAATCGCATCATACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12922
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026701 Nonsense 309 451 9 11
ENSDART00000110716 None None 264 None 9
Genomic Location:
Chromosome 3 (position 37058125)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGATGAGGAGGCTCCTGCAGCCTAAAAATGTCATGGTGTCCACAGGC[C/T]GAGACCGTCAGACCAACCACTGCTACATCGCCATCCTCAACATCATCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/13emyt2g