LOC100000501

Ensembl ID:
ENSDARG00000015601
Human Orthologue:
KIF19
Human Description:
kinesin family member 19 [Source:HGNC Symbol;Acc:26735]
Mouse Orthologue:
Gpr142
Mouse Description:
G protein-coupled receptor 142 Gene [Source:MGI Symbol;Acc:MGI:2668437]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22159 Nonsense Mutation detected in F1 DNA During 2014
sa18523 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22159
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017640 Nonsense 179 368 2 2
Genomic Location:
Chromosome 12 (position 37604845)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTGGCGCTGGCATCCGGAGTGCCATTCTTCTGGTGGTCGGACATGTG[G/A]AGGGTCAGTCATGAGCCCAACAACCTGGATACCGCCTTGATTTGGACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18523
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017640 Nonsense 194 368 2 2
Genomic Location:
Chromosome 12 (position 37604890)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGGAGGGTCAGTCATGAGCCCAACAACCTGGATACCGCCTTGATTTG[G/A]ACCCACGTGRCTATYATTTACTTTCTTCCCTGCTGCATCTTCCTGGTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ukcaajyy