ankrd33bb

Ensembl ID:
ENSDARG00000015589
ZFIN ID:
ZDB-GENE-070912-531
Human Orthologue:
ANKRD33B
Human Description:
ankyrin repeat domain 33B [Source:HGNC Symbol;Acc:35240]
Mouse Orthologue:
Ankrd33b
Mouse Description:
ankyrin repeat domain 33B Gene [Source:MGI Symbol;Acc:MGI:1917904]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18087 Nonsense Available for shipment Available now
sa6014 Nonsense Mutation detected in F1 DNA During 2014
sa19786 Nonsense Mutation detected in F1 DNA During 2014
sa19787 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18087
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011729 Nonsense 34 451 1 5
ENSDART00000146518 Nonsense 40 448 1 4
Genomic Location:
Chromosome 2 (position 30246673)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGGCATCAGATGACTCCTTCTACCCACCTGATGATTCGCTCAGCTTC[G/T]AGAAATGCCCGAGTCCTGAGAGCCCAGAGCCRGTCAGCTTTTTCAAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6014
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011729 Nonsense 91 451 2 5
ENSDART00000146518 Nonsense 97 448 2 4
Genomic Location:
Chromosome 2 (position 30258760)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTCTYTGCTTAACAGACAGGTCTGATAGTGGCGTGTTACCAGGGCTA[C/A]GTGGATGTGGTCATTGCACTGTCCCAGTGCCCACATGTGGACGTGAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19786
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011729 Nonsense 190 451 4 5
ENSDART00000146518 Nonsense 196 448 4 4
Genomic Location:
Chromosome 2 (position 30262289)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTGAAGCAAGAGACTTTGGCCGTAAACTGACACCACAGGAATGGGCCT[T/A]GTTTACAGGCCGCTACGAGACTGCCAAACTGATTTCCAGACTGATGGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19787
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011729 Nonsense 306 451 4 5
ENSDART00000146518 Nonsense 312 448 4 4
Genomic Location:
Chromosome 2 (position 30262636)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCCCCGTGTGTAGGAAAACGGCGTCCTGCCGTGCAGGATATCCTTCGC[A/T]GACAACGGCTGGCTGAACTGAAGAACCTCGGACCCGATCGCCTCAACAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ibtanolt