dnmt6

Ensembl ID:
ENSDARG00000015566
ZFIN ID:
ZDB-GENE-050314-3
Description:
DNA (cytosine-5)-methyltransferase 3A [Source:RefSeq peptide;Acc:NP_001018150]
Human Orthologues:
DNMT3A, DNMT3L
Human Descriptions:
DNA (cytosine-5-)-methyltransferase 3 alpha [Source:HGNC Symbol;Acc:2978]
DNA (cytosine-5-)-methyltransferase 3-like [Source:HGNC Symbol;Acc:2980]
Mouse Orthologues:
Dnmt3a, Dnmt3l
Mouse Descriptions:
DNA (cytosine-5-)-methyltransferase 3-like Gene [Source:MGI Symbol;Acc:MGI:1859287]
DNA methyltransferase 3A Gene [Source:MGI Symbol;Acc:MGI:1261827]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36471 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36471
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005239 Essential Splice Site 591 731 14 18
ENSDART00000126823 Essential Splice Site 591 731 14 18
ENSDART00000127557 Essential Splice Site 838 978 18 22
Genomic Location (Zv9):
Chromosome 17 (position 37114629)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 36999526
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGGCCATGGGCGTCAGCGACAAAAGGGACATCTCTCGCTTTTTAGAGG[T/C]TTACAGCGATTGATATCATTATTTTTGTTCTGGTTGAGATGAAATTGTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link