psen2

Ensembl ID:
ENSDARG00000015540
ZFIN ID:
ZDB-GENE-000330-9
Description:
Presenilin-2 [Source:UniProtKB/Swiss-Prot;Acc:Q90ZE4]
Human Orthologue:
PSEN2
Human Description:
presenilin 2 (Alzheimer disease 4) [Source:HGNC Symbol;Acc:9509]
Mouse Orthologue:
Psen2
Mouse Description:
presenilin 2 Gene [Source:MGI Symbol;Acc:MGI:109284]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16972 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16972
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006381 Essential Splice Site 45 441 3 11
Genomic Location (Zv9):
Chromosome 1 (position 51567613)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 50414492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTATTCCAGTGTAAAGTTAAGGCTGATGTGTGTGTGGTCTCCTCCAC[A/T]GAGCGGTGCGGTCCGCTCGAGGTCYGCCTCGGGCTCTGGAGATGYCRGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link