gad2

Ensembl ID:
ENSDARG00000015537
ZFIN ID:
ZDB-GENE-030909-9
Description:
glutamate decarboxylase 2 [Source:RefSeq peptide;Acc:NP_001017708]
Human Orthologue:
GAD2
Human Description:
glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) [Source:HGNC Symbol;Acc:4093]
Mouse Orthologue:
Gad2
Mouse Description:
glutamic acid decarboxylase 2 Gene [Source:MGI Symbol;Acc:MGI:95634]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37819 Nonsense Mutation detected in F1 DNA During 2017
sa30034 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37819
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021609 Nonsense 135 583 4 16
ENSDART00000114229 Nonsense 135 187 4 5

The following transcripts of ENSDARG00000015537 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 6240543)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6127835
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATATAGTGGAATCATTTGACAGGTCTACGAAAGTGATTGATTTCCACTA[T/A]CCAAACGAACTGCTCCAAAGGAATAATTGGGAGCTTTCGGACGAACCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30034
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021609 Nonsense 423 583 13 16
ENSDART00000114229   None 187 None 5

The following transcripts of ENSDARG00000015537 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 6230403)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 6117695
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTGATCCAGGGACTGATGCAGAGCTGCAATCAGATGCAGGCCTGTTA[T/A]CTGTTCCAGCAGGACAAGCATTATGACCTGCAGTATGACACAGGAGACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link