si:dkey-169l5.3

Ensembl ID:
ENSDARG00000015530
ZFIN ID:
ZDB-GENE-070424-211
Description:
Novel protein similar to vertebrate gamma-aminobutyric acid (GABA) A receptor, beta 3 (GABRB3) [Sour
Human Orthologue:
GABRQ
Human Description:
gamma-aminobutyric acid (GABA) receptor, theta [Source:HGNC Symbol;Acc:14454]
Mouse Orthologue:
Gabrq
Mouse Description:
gamma-aminobutyric acid (GABA) A receptor, subunit theta Gene [Source:MGI Symbol;Acc:MGI:1888498]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43691 Nonsense Mutation detected in F1 DNA During 2017
sa31063 Nonsense Mutation detected in F1 DNA During 2017
sa39341 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43691
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064718 Nonsense 129 512 4 10
ENSDART00000145280   None 203 None 2
ENSDART00000064718 Nonsense 129 512 4 10
ENSDART00000145280   None 203 None 2
Genomic Location (Zv9):
Chromosome 21 (position 35255987)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 36427294
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGGCGGATCAGTTGTGGCTCCCGGATACTTATTTCCTGAACGACAAG[A/T]AGAGTTTCTTGCACGGAGTGACGGTGAAAAACCGGATGATCCGCCTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31063
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064718 Nonsense 129 512 4 10
ENSDART00000145280   None 203 None 2
ENSDART00000064718 Nonsense 129 512 4 10
ENSDART00000145280   None 203 None 2
Genomic Location (Zv9):
Chromosome 21 (position 35255987)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 36427294
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGGCGGATCAGTTGTGGCTCCCGGATACTTATTTCCTGAACGACAAG[A/T]AGAGTTTCTTGCACGGAGTGACGGTGAAAAACCGGATGATCCGCCTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39341
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064718 Nonsense 250 512 7 10
ENSDART00000145280   None 203 None 2
Genomic Location (Zv9):
Chromosome 21 (position 35281961)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 36401320
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGTCGTTGAGTTTCCGCATCAAGAGAAACATCGGCTACTTTATCCTG[C/T]AGACTTACATGCCCTCCATCCTGATCACAATCTTGTCCTGGGTCTCCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link