mc4r

Ensembl ID:
ENSDARG00000015515
ZFIN ID:
ZDB-GENE-021223-2
Description:
melanocortin receptor 4 [Source:RefSeq peptide;Acc:NP_775385]
Human Orthologue:
MC4R
Human Description:
melanocortin 4 receptor [Source:HGNC Symbol;Acc:6932]
Mouse Orthologue:
Mc4r
Mouse Description:
melanocortin 4 receptor Gene [Source:MGI Symbol;Acc:MGI:99457]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa122 Nonsense Available for shipment Available now
sa148 Nonsense Available for shipment Available now
sa149 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa122
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019555 Nonsense 19 326 1 1
Genomic Location:
Chromosome 2 (position 28100714)
KASP Assay ID:
554-1630.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACCTCACATCATCATGGACTGCATCATTCATTTCGGAACCACAGCCAA[G/T]GAGCTCTGCCGGTGGGAAAGCCCTCTCATGGTGACWGAGGATCAGCTTCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa148
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019555 Nonsense 31 326 1 1
Genomic Location:
Chromosome 2 (position 28100750)
KASP Assay ID:
554-0040.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAACCACAGCCAAKGAGCTCTGCCGGTGGGAAAGCCCTCTCATGGTGAC[A/T]GAGGATCAGCTTCTGGATGCTACGAGCAGYTGCTGATCTCCACGGARRTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa149
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019555 Nonsense 186 326 1 1
Genomic Location:
Chromosome 2 (position 28101216)
KASP Assay ID:
554-0050.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCATCTGGACCTTCTGCACAGTCTCCGGCGTACTCTTTATCGTGTATT[C/T]AGAAAGCACCACTGTTCTCATCTGCCTCATCAGCATGTTCTTCACCATGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Antipsychotic drug-induced weight gain: Association between common variants near the melanocortin 4 receptor gene and severe antipsychotic drug-induced weight gain. (View Study)
  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Body mass index: Common variants at CDKAL1 and KLF9 are associated with body mass index in east Asian populations. (View Study)
  • Body mass index: Common variants near MC4R are associated with fat mass, weight and risk of obesity. (View Study)
  • Body mass index: Six new loci associated with body mass index highlight a neuronal influence on body weight regulation. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Obesity: Genome-wide association study for early-onset and morbid adult obesity identifies three new risk loci in European populations. (View Study)
  • Obesity (extreme): Two new Loci for body-weight regulation identified in a joint analysis of genome-wide association studies for early-onset extreme obesity in French and german study groups. (View Study)
  • Obesity and blood pressure: Genome-wide scan for loci of adolescent obesity and their relationship with blood pressure. (View Study)
  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)
  • Waist circumference: NRXN3 is a novel locus for waist circumference: a genome-wide association study from the CHARGE Consortium. (View Study)
  • Waist circumference and related phenotypes: Common genetic variation near MC4R is associated with waist circumference and insulin resistance. (View Study)
  • Weight: Genome-wide association yields new sequence variants at seven loci that associate with measures of obesity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8b86b1l2