klf5a

Ensembl ID:
ENSDARG00000015506
ZFIN ID:
ZDB-GENE-090312-167
Description:
Novel protein similar to H.sapiens KLF5, Kruppel-like factor 5 (Intestinal) (KLF5) [Source:UniProtKB
Human Orthologue:
KLF5
Human Description:
Kruppel-like factor 5 (intestinal) [Source:HGNC Symbol;Acc:6349]
Mouse Orthologue:
Klf5
Mouse Description:
Kruppel-like factor 5 Gene [Source:MGI Symbol;Acc:MGI:1338056]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19526 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19526
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004361 Essential Splice Site 57 429 1 4
ENSDART00000136923   None 375 None 3
Genomic Location (Zv9):
Chromosome 1 (position 34245000)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 33879751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACAAGAATCCTGACTCGGAAAGGGGCTTATCCAACGACTATTCTCAGG[T/A]AATTTGGAGTTTTGCCTTTTCATTGTGCTCAAGACAGTGGATATTATTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Pancreatic cancer: A genome-wide association study identifies pancreatic cancer susceptibility loci on chromosomes 13q22.1, 1q32.1 and 5p15.33. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link